pTargeT™ Sequencing Primer

Q4461_pTARGET--Sequencing-Primer--24mer--1-26_3
customize-this-small
View information on global supply logistics

We are sorry, but this product is discontinued.

For more information, contact Technical Service.

Please Enquire
This product is discontinued
This product is available under our Early Access program - Learn More
This product is available under our Catalog (FT) program - Learn More
pTargeT™ Sequencing Primer

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

Specifications

What's in the box?

Item Part # Size

pTargeT™ Sequencing Primer (24mer)

Q446A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Let's find the product that meets your needs.

Talk to a Scientist

Sabine

Sabine

Germany